Flyer

International Journal of Drug Development and Research

  • ISSN: 0975-9344
  • Journal h-index: 56
  • Journal CiteScore: 46.50
  • Journal Impact Factor: 26.99
  • Average acceptance to publication time (5-7 days)
  • Average article processing time (30-45 days) Less than 5 volumes 30 days
    8 - 9 volumes 40 days
    10 and more volumes 45 days
Awards Nomination 20+ Million Readerbase
Indexed In
  • Genamics JournalSeek
  • China National Knowledge Infrastructure (CNKI)
  • CiteFactor
  • Scimago
  • Directory of Research Journal Indexing (DRJI)
  • OCLC- WorldCat
  • Publons
  • MIAR
  • University Grants Commission
  • Euro Pub
  • Google Scholar
  • J-Gate
  • SHERPA ROMEO
  • Secret Search Engine Labs
  • ResearchGate
  • International Committee of Medical Journal Editors (ICMJE)
Share This Page

- (2015) Volume 7, Issue 1

Isolation and Characterization of Heavy Metal Tolerant Bacterial Isolates VITNJ12 and VITNJ13 from Paper Mill Effluent, Erode District, Tamilnadu, India.

Rachita Gupta, Sudharsana Sundarrajan, Mohana Priya. K, Mohana Priya Arumugam, Palanichamy V, Nancy Veena Kumari D
School of Biosciences and Technology, VIT University, Vellore - 632014, Tamilnadu, India.
E-mail: nancyveenakumari@gmail.com
Date of Submission: 02-03-2015Date of Acceptance: 17-03-2015 Conflict of Interest: NIL Source of Support: NONE
Copyright: © 2015 Nancy Veena Kumari D et al, publisher and licensee IYPF. This is an Open Access article which permits unrestricted noncommercial use, provided the original work is properly cited.
Related article at Pubmed, Scholar Google
Visit for more related articles at International Journal of Drug Development and Research

Abstract

In this present study total six bacterial isolates were obtained from paper mill effluent collected from Erode district, Tamilnadu, India. Out of these, two isolates VITNJ12 and VITNJ13 has shown the resistance to heavy metals at maximum concentration of 300mg/ml. Then, the isolates were further characterized by morphological, biochemical and molecular technique and the isolates were found to be Acinetobacterschindeleri and Lysinibacillussphaericus. Both the isolates have shown the maximum resistance to antibiotics such as Rifampicin, Miconazole, Fluconazole, Ceflazidime and Methicillin. The heavy metal and antibiotic resistant bacteria isolated from paper mill effluent could be further explored for bioremediation purpose

Keywords:

Effluent, heavy metal resistance bacteria, antibiotic resistance, 16SrRNA.

INTRODUCTION

Paper pulp industries are one the largest effluent generating industries of the world [1]. The paper mill industry consumes water nearly 275-455 cum for the production of one tone of paper which forms effluents and needs reclamation and disposal [2]. The disposal of effluents directly to the fresh water bodies affects the quality of the water and since most of the water applied for irrigating the agricultural land and seriously affects the nature of the soil [3]. This effluent contains 700 organic and inorganic compounds [4] most of them are heavy metals. Heavy metals are group of metals whose density is greater than 5g/cm3contaminates the environment due to their toxicological effect to living organisms [5]. They are very stable, cannot be destroyed or degraded and so persistent in nature [6]. Heavy metals influence the microbial population by affecting the growth and biochemical activity leads to decrease in biomass. Therefore, microbes have developed many mechanisms to tolerate the heavy metals for their survival [7]. These main mechanisms include the efflux of metal ions outside the cell [8]. An emerging problem for the treatment of infectious disease is bacterial resistance to antibiotics. It is thought that there is relationship exists between metal tolerance and antibiotic resistance in bacteria because of the similarity of that resistance genes to antibiotics and heavy metals might be closely together on the same plasmid in bacteria [9]. Many studies were reported on isolation of antibiotic resistance and heavy tolerance bacteria from the highly polluted environment [10]. Hence, this study was carried out to isolate and characterize the antibiotic resistance and heavy metal tolerance bacteria from the paper mill effluent near the Kaveri river basin, Erode district, Tamilnadu.

MATERIALS AND METHODS

Sample collection site: Samples were collected from the contaminated site of Erode district, Tamilnadu in a sterile plastic container, transported to the microbiological laboratory, VIT University and they were stored in the refrigerator at 4ºC. The physicochemical properties of the effluents were estimated using the standard methods.

Isolation and identification of heavy metal tolerant bacteria:

Bacteria were isolated by serially diluting sample and plated in Nutrient agar plate were supplemented with individual heavy metals in the form of salts K2Cr2O7, CdCl2, CuCl2 and NiSO4 respectively at the concentration of 50ppm. The plates were incubated for 24 hrs at 37ºC for their bacterial growth. Then, the distinct colonies were sub cultured continuously on the suitable medium for the isolation of pure culture. Pure cultures were further identified on the basis of their morphology and biochemical tests. The isolated colonies were characterized on the basis of gram staining, hanging drop motility test, oxidase test, catalase test and IMVIC test. To isolate the heavy metal tolerant strains, it is mandatory to standardize the cultural and physiological conditions of the selected organisms. Among these, temperature, pH and salt concentration are of importance for the growth of bacteria. The molecular characterization of the bacteria was done by 16s r RNA sequencing. [11]. The purified PCR products of approximately 1,400 bp were sequenced by using 2 primers: 518F 5’ CCAGCAGCCGCGGTAATACG3’and 800R 5’TACCAGGGTATCTAATCC3’ .Sequencing was performed by using Big Dye terminator cycle sequencing kit (Applied BioSystems, USA). Sequencing products were resolved on an Applied Biosystems model 3730XL automated DNA sequencing system (Applied BioSystems, USA). 16S rRNA sequences of bacterial isolates have been deposited in the Gen Bank database under the accession no.KM047497 and KM047498. The partial 16SrRNA bacterial sequences isolated from paper mill effluent samples were analysed using BioEdit software [12]. The sequences were compared with the available sequences against 16S ribosomal RNA sequences (Bacteria and Archaea) database using NCBI’s BlastN. Sequences were aligned using CLUSTALW program in Mega 6.0. A Neighbour-joining tree assessing the phylogenetic diversity of the sequences was constructed using Jukes and Cantor method. Bootstrap analysis was performed on 1000 random samples taken from the multiple sequence alignment.

MIC of bacterial isolatesto heavy metal tolerance:

The isolates were tested for metal tolerance using five various concentrations of four different metals. The salt and its concentrations used were shown in the Table 1. The minimum inhibitory concentration of the metal ions at which no growth was determined by the broth dilution method [13].

Antibiotic resistance test

The isolates were screened for antibiotic sensitivity according to the Kirby-Bauer disc diffusion method [14] with 8 antibiotics. The concentrations of the disc used were Streptomycin (10 mcg), Ampicilin (10 mcg), Rifampicin (15 mcg), Miconazole (30mcg), Methicillin (5mcg), Fluconazole (10 mcg), Ceflazidime (30 mcg) and Ciprofloxacin (10 mcg). 0.1 ml of bacterial culture was uniformly spread on a sterile Muller Hinton agar plate. The culture was allowed to dry on the plate for 5-10 min at room temperature, antibiotic impregnated disc were placed on the plates aseptically on the bacterial colonies on agar plates. The plates were incubated for 18 -24 hrs at 37ºC. The diameter of the inhibition zone was measured and the isolates were classified as resistant (R) and Susceptible (S) following the standard method.

RESULTS

The result of the physical and chemical properties of the paper mill effluent as presented in the Table A total of six bacterial isolates (J1, VITJ12, J3, J4, J5 and VITNJ13) from paper mill effluents were isolated and tested for resistance against certain heavy metals such as chromium, cadmium, copper and nickel. Out of six, two bacterial isolates (VITNJ12, VITNJ13) have shown resistance towards the heavy metals as shown in Table 3 and they were selected for further studies. The morphological and biochemical characteristics of the two isolates (VITNJ12, VITNJ13) were examined and the results are depicted in Table 4.
Both the isolates VITNJ12 and VITNJ13 were found to be multi-antibiotic resistant as shown in the Table 5. The presence of small amount of antibiotics and heavy metals in the paper mill effluent induce the emergence of antibiotic and heavy metal resistant bacterial isolates. Both the isolates in the present study showed multiple tolerances to both heavy metals and antibiotics.
The microbial resistance to heavy metal is attributed to a variety of detoxifying mechanism developed by resistant microorganisms such as complexation by exopolysaccharides, binding with bacterial cell envelopes, metal reduction, metal efflux etc. In the present study, it is suggested that the microorganisms resistant to antibiotics and tolerant to metals appear to be the result of exposure to metal contaminated environment which is fairly consistent with the finding of Remeteke [15]. The fact was also established by other researchers that multiple metal resistance bacterial isolates exhibits high resistance towards a group of antibiotics [16]. Based on the MIC values and antibiotic pattern of the isolate strains and as studied by Bruins et al.,[17]Pseudomonas sp.Shows resistance to a variety of toxic substances, heavy metal and antibiotics which has generated a high degree of interest in the area of environment bioremediation. Further studies are required to understand the role of these two isolates VITNJ12 and VITNJ13 in bioremediation.

ACKNOWLEDGEMENT

We are thankful to the authority of VIT University for the facilities and their constant support.

Tables at a glance

Table icon Table icon Table icon Table icon Table icon
Table 1 Table 2 Table 3 Table 4 Table 5

Figures at a glance

Figure 1
Figure 1
 
5506

References

  1. 1) Ugurulu M, Karaoglu MH, Kula I. Experimental investigation of chemical oxygen demand, lignin and phenol removal from paper mill effluents using three-phase three-dimensional electrode reactor. Polish J. Of Environ. Stud., 2006;15(4): 647- 54.
  2. 2) Kannan K and ObilsamiG. Decolorization of pulp and paper mill effluent by growth of Aspergillusniger. World J MicrobiolBiotechnol., 1990;6:114–16.
  3. 3) Gillespie, WJ. Pulp and paper effluent management. J Water Pollut Con F., 1987; 59(6): 456-57.
  4. 4) Tambekar D H, Dhore HR, Kotwal AD, Shirbhate AP, Solav PB. Prevalence and antibiotic sensitivity profile of human enteric pathogens from water sources in salinity affected villages of Vidarbha (India).Res. J. Agric. Biol. Sci., 2008; 4:712-16.
  5. 5) Bruins MR, Kapal S, Oehme WF. Microbial resistance to metals in the environment.Ecotoxicol Environ Saf., 2000; 45: 198-207.
  6. 6) GochfeldM. Cases of mercury exposure, bioavailability, and absorption Ecotoxicol Environ Saf ., 2003;56: 174-79.
  7. 7) GaddGM..In Microbial Mineral Recovery (Ehrlich, HL and Brierley, CL., Eds.).McGraw- Hill, New York.1990; 249-75.
  8. 8) Spain A. Implications of microbial heavy metal tolerance in the environment, Reviews in Undergraduate Research., 2003; 2: 1-6.
  9. 9) Smith JJ, Howington JP, McFeter. G.aAntart.-J.- U.S., 1993; 28: 123-24.
  10. 10) Ezaka E, Anyanwu CU. Chromium (VI) tolerance of bacterial strains isolated from sewage oxidation ditch. Int J environ science.,2011;1:7: 1725-34.
  11. 11) Holt JG, Krig NR, Sneath PHA, Staley JT, Williams ST. Bergey’s manual of determinative bacteriology (9thedn). Baltimore, Maryland: Williams and Wilkins.1994.
  12. 12) Hall, T.A, BioEdit:a user –friendly biological sequence alignment editor and 570 analysis program for windows 95/ 98 / NT .Nucleic acid symp.Ser., 41 (1999) 95-98
  13. 13) Calomins JJ, Armstrong JL, Scidler. Association of metal tolerance with multiple antibiotic resistances of bacteria isolated from drinking water. Applied Environ. Microbiol.1984; 47: 1238- 42.
  14. 14) Bauer AW , Kirby WWM, SherrisJC,Turck M. Antibiotic susceptibility testing by a standard single disc method. Am. J. Clin.Pathol., 1996;45, 493-496.
  15. 15) Ramtake PW. Plasmid mediated co-transfer of antibiotic resistance and heavy metal tolerance in coliform. Ind. J.Microbiol., 1997; 27: 177-81.
  16. 16) Vajiheh K, Naser B. Antimicrobial, heavy metal resistance and plasmid profile of coliforms isolated from nosocomial infections in a hospital in Isfahan, Iran. African J. Biotechnol., 2003; 2(10): 379-383.
  17. 17) Bruins MR, Kapil S, Oehme FW, Characterization of a small plasmid (pMBCP) from bovine Pseudomonas pickettii that confers cadmium resistance, Ecotox. Environ. Safe, 2003; 54(3), 241- 248. D et al; Isolation and Characterization of Heavy Metal Tolerant Bacterial Isolates VITNJ12 and VITNJ13 fro